-
PurposeLentivirus for expression of Venus-Fluc (firefly luciferase) fusion protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140328 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti PGK Puro DEST (Addgene #19068)
-
Backbone manufacturerEric Campeau & Paul Kaufman
- Backbone size w/o insert (bp) 9599
- Total vector size (bp) 10372
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVenus-Firefly Luciferase (luc2)
-
SpeciesSynthetic; Aequorea victoria (Venus) and Photinus pyralis (luciferase)
-
Insert Size (bp)2400
- Promoter human PGK promoter
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer hPGK-F GTGTTCCGCATTCTGCAAG
- 3′ sequencing primer WPRE-R catagcgtaaaaggagcaaca
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Firefly luciferase gene was retrieved from Addgene plasmid MSCV-Fluc PGK-hygro (Addgene #18782) and added in frame behind a Venus cDNA. The pLenti-PGK-Venus-Fluc is in its structure identical to pLenti-PGK-Venus-Akaluc (Addgene #124701), except the different Luciferase version.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-PGK-Venus-Fluc (puro) was a gift from Roland Friedel (Addgene plasmid # 140328 ; http://n2t.net/addgene:140328 ; RRID:Addgene_140328) -
For your References section:
Akaluc bioluminescence offers superior sensitivity to track in vivo glioma expansion. Bozec D, Sattiraju A, Bouras A, Jesu Raj JG, Rivera D, Huang Y, Junqueira Alves C, Tejero R, Tsankova NM, Zou H, Hadjipanayis C, Friedel RH. Neurooncol Adv. 2020 Oct 10;2(1):vdaa134. doi: 10.1093/noajnl/vdaa134. eCollection 2020 Jan-Dec. 10.1093/noajnl/vdaa134 PubMed 33241215