pSinREP5-iAchSnFR
(Plasmid
#140643)
-
PurposeAcetylcholine sensor for sindbis virus
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140643 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSinREP5
- Backbone size w/o insert (bp) 9951
- Total vector size (bp) 11826
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAch sensor V9
-
Insert Size (bp)1844
- Promoter SP6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCATAGTACATTTCATCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSinREP5-iAchSnFR was a gift from J. Julius Zhu (Addgene plasmid # 140643 ; http://n2t.net/addgene:140643 ; RRID:Addgene_140643) -
For your References section:
A fast genetically encoded fluorescent sensor for faithful in vivo acetylcholine detection in mice, fish, worms and flies. Borden PM, Zhang P, Shivange AV, Marvin JS, Cichon J, Dan C, Podgorski K, Figueiredo A, Novak O, Tanimoto M, Shigetomi E, Lobas MA, Kim H, Zhu PK, Zhang Y, Zheng WS, Fan C, Wang G, Xiang B, Gan L, Zhang G, Guo K, Lin L, Cai Y, Yee AG, Aggarwal A, Ford CP, Rees DC, Dietrich D, Khakh BS, Dittman JS, Gan W, Koyama M, Jayaraman V, Cheer JF, Lester HA, Zhu JJ, Looger LL. bioRxiv 2020 10.1101/2020.02.07.939504