Skip to main content
Addgene

pcDNA3.1-GGamma1-GFP2
(Plasmid #140989)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140989 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5432
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GGamma1-GFP2
  • Alt name
    GNGT1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    957
  • Entrez Gene
    GNGT1 (a.k.a. GNG1, HG3G1)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP2 and GSAG linker (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-GGamma1-GFP2 was a gift from Bryan Roth (Addgene plasmid # 140989 ; http://n2t.net/addgene:140989 ; RRID:Addgene_140989)
  • For your References section:

    TRUPATH, an open-source biosensor platform for interrogating the GPCR transducerome. Olsen RHJ, DiBerto JF, English JG, Glaudin AM, Krumm BE, Slocum ST, Che T, Gavin AC, McCorvy JD, Roth BL, Strachan RT. Nat Chem Biol. 2020 May 4. pii: 10.1038/s41589-020-0535-8. doi: 10.1038/s41589-020-0535-8. 10.1038/s41589-020-0535-8 PubMed 32367019