Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

SEP-Nanoluc-cyOFP1
(Plasmid #141082)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 141082 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCDH-EF1-MCS-T2A-Puro
  • Backbone manufacturer
    System Biosciences (SBI)
  • Backbone size w/o insert (bp) 7068
  • Total vector size (bp) 9207
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SEP-Nanoluc-cyOFP1
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    2139
  • Mutation
    Deletion of amino acids DISGG from positions 673 till 677 (Please see Depositor comments)
  • Promoter EF1α

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer EF1 Forward (CTCCACGCTTTGCCTGACCCTGCTT)
  • 3′ sequencing primer T2A Reverse (CGTCACCGCATGTTAGAAGACTTCCTCTGC)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Depositor confirmed that this deletion does not affect the fluorescent expression of cyOFP1.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SEP-Nanoluc-cyOFP1 was a gift from Jeak Ling Ding (Addgene plasmid # 141082 ; http://n2t.net/addgene:141082 ; RRID:Addgene_141082)
  • For your References section:

    pHLuc, a Ratiometric Luminescent Reporter for in vivo Monitoring of Tumor Acidosis. Ong TT, Ang Z, Verma R, Koean R, Tam JKC, Ding JL. Front Bioeng Biotechnol. 2020 May 8;8:412. doi: 10.3389/fbioe.2020.00412. eCollection 2020. 10.3389/fbioe.2020.00412 PubMed 32457886