Skip to main content

pPEPZ-sgRNAclone
(Plasmid #141090)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 141090 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPEPZ
  • Backbone size w/o insert (bp) 4416
  • Total vector size (bp) 5155
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • gRNA/shRNA sequence
    structure sequence: dCas9 handle binding and terminator sequence
  • Species
    Synthetic
  • Promoter p3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer aattcggtcgacagatcttcg
  • 3′ sequencing primer caagcagaagacggcatacg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPEPZ-sgRNAclone was a gift from Jan-Willem Veening (Addgene plasmid # 141090 ; http://n2t.net/addgene:141090 ; RRID:Addgene_141090)
  • For your References section:

    Exploration of Bacterial Bottlenecks and Streptococcus pneumoniae Pathogenesis by CRISPRi-Seq. Liu X, Kimmey JM, Matarazzo L, de Bakker V, Van Maele L, Sirard JC, Nizet V, Veening JW. Cell Host Microbe. 2021 Jan 13;29(1):107-120.e6. doi: 10.1016/j.chom.2020.10.001. Epub 2020 Oct 28. 10.1016/j.chom.2020.10.001 PubMed 33120116