pPEPZ-sgRNAclone
(Plasmid
#141090)
-
PurposeThis vector is designed for efficient cloning of sgRNAs by Golden Gate assembly. The sgRNA insertion leads to replacement of mCherry, resulting in loss of red color of E. coli colony.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141090 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPEPZ
- Backbone size w/o insert (bp) 4416
- Total vector size (bp) 5155
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
gRNA/shRNA sequencestructure sequence: dCas9 handle binding and terminator sequence
-
SpeciesSynthetic
- Promoter p3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer aattcggtcgacagatcttcg
- 3′ sequencing primer caagcagaagacggcatacg
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPEPZ-sgRNAclone was a gift from Jan-Willem Veening (Addgene plasmid # 141090 ; http://n2t.net/addgene:141090 ; RRID:Addgene_141090) -
For your References section:
Exploration of Bacterial Bottlenecks and Streptococcus pneumoniae Pathogenesis by CRISPRi-Seq. Liu X, Kimmey JM, Matarazzo L, de Bakker V, Van Maele L, Sirard JC, Nizet V, Veening JW. Cell Host Microbe. 2021 Jan 13;29(1):107-120.e6. doi: 10.1016/j.chom.2020.10.001. Epub 2020 Oct 28. 10.1016/j.chom.2020.10.001 PubMed 33120116