Skip to main content

Tn7 helper plasmid
(Plasmid #141161)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 141161 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSC101 temperature-sensitive origin of replication
  • Backbone size w/o insert (bp) 5932
  • Total vector size (bp) 12042
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    temperature sensitive plasmid
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tn7 transposon machinery
  • Alt name
    tnsABCD
  • Species
    Tn7
  • Insert Size (bp)
    6110
  • Promoter Arabinose-inducible pBAD

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer attgccgtcactgcgtcttttac
  • 3′ sequencing primer actgttaaccaccttagctcgac
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Jesse Lerner

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tn7 helper plasmid was a gift from Shimon Bershtein (Addgene plasmid # 141161 ; http://n2t.net/addgene:141161 ; RRID:Addgene_141161)
  • For your References section:

    Chromosomal barcoding of E. coli populations reveals lineage diversity dynamics at high resolution. Jasinska W, Manhart M, Lerner J, Gauthier L, Serohijos AWR, Bershtein S. Nat Ecol Evol. 2020 Feb 24. pii: 10.1038/s41559-020-1103-z. doi: 10.1038/s41559-020-1103-z. 10.1038/s41559-020-1103-z PubMed 32094541