-
PurposeTemperature-sensitive plasmid carries tnsABCD genes that encode transposase biochemical machinery under an arabinose-inducible pBAD promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141161 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSC101 temperature-sensitive origin of replication
- Backbone size w/o insert (bp) 5932
- Total vector size (bp) 12042
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionstemperature sensitive plasmid
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTn7 transposon machinery
-
Alt nametnsABCD
-
SpeciesTn7
-
Insert Size (bp)6110
- Promoter Arabinose-inducible pBAD
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer attgccgtcactgcgtcttttac
- 3′ sequencing primer actgttaaccaccttagctcgac
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byJesse Lerner
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tn7 helper plasmid was a gift from Shimon Bershtein (Addgene plasmid # 141161 ; http://n2t.net/addgene:141161 ; RRID:Addgene_141161) -
For your References section:
Chromosomal barcoding of E. coli populations reveals lineage diversity dynamics at high resolution. Jasinska W, Manhart M, Lerner J, Gauthier L, Serohijos AWR, Bershtein S. Nat Ecol Evol. 2020 Feb 24. pii: 10.1038/s41559-020-1103-z. doi: 10.1038/s41559-020-1103-z. 10.1038/s41559-020-1103-z PubMed 32094541