ER-HA-mNG21-10
(Plasmid
#141165)
-
PurposeSplit Fluorescent Reporter for ER Retrograde Trafficking
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 141165 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEf1apHAGE-IRES-Blasticidin
- Backbone size w/o insert (bp) 7400
-
Modifications to backboneDerived from pHAGE-shortEF1a-MCS-IRES-ZsGreen
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameER-HA-mNG21-10-KDEL
-
SpeciesSynthetic
-
Insert Size (bp)763
-
MutationK128M, S142T, R150M, G172V and K213M
- Promoter Ef1a
-
Tag
/ Fusion Protein
- Signal Sequence, KDEL and HA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Xho1 (unknown if destroyed)
- 5′ sequencing primer ATATAAGTGCAGTAGTCGCCG
- 3′ sequencing primer ATATAGACAAACGCACACCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ER-HA-mNG21-10 was a gift from Wayne Lencer (Addgene plasmid # 141165 ; http://n2t.net/addgene:141165 ; RRID:Addgene_141165) -
For your References section:
A quantitative single-cell assay for retrograde membrane traffic enables rapid detection of defects in cellular organization. Luong P, Li Q, Chen PF, Wrighton PJ, Chang D, Dwyer S, Bayer MT, Snapper SB, Hansen SH, Thiagarajah JT, Goessling W, Lencer WI. Mol Biol Cell. 2019 Nov 27:mbcE19070375. doi: 10.1091/mbc.E19-07-0375. 10.1091/mbc.E19-07-0375 PubMed 31774722