ER-HA-mNG21-10
(Plasmid #141165)

• Purpose: Split Fluorescent Reporter for ER Retrograde Trafficking
• Depositing Lab: Wayne Lencer
• Publication: Luong et al Mol Biol Cell. 2019 Nov 27:mbcE19070375. doi: 10.1091/mbc.E19-07-0375.

Backbone

• Vector backbone: Ef1apHAGE-IRES-Blasticidin
• Backbone size w/o insert (bp): 7400
• Modifications to backbone: Derived from pHAGE-shortEF1a-MCS-IRES-ZsGreen
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ER-HA-mNG21-10-KDEL
• Species: Synthetic
• Insert Size (bp): 763
• Mutation: K128M, S142T, R150M, G172V and K213M
• Promoter: Ef1a
• Tag / Fusion Protein:
  • Signal Sequence, KDEL and HA

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (not destroyed)
• 3′ cloning site: Xho1 (unknown if destroyed)
• 5′ sequencing primer: ATATAAGTGCAGTAGTCGCCG
• 3′ sequencing primer: ATATAGACAAACGCACACCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry