pMig (Martins Lab)
(Plasmid
#14125)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 14125 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRetroSuper
- Backbone size w/o insert (bp) 6349
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameIRES-EGFP
-
Insert Size (bp)1310
-
MutationCla I sites were silenced in the original pRetroSuper vector
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (unknown if destroyed)
- 3′ cloning site ClaI (unknown if destroyed)
- 5′ sequencing primer CGTGCGCCCTGGCAGGAAGATGG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid expresses EGFP from an IRES sequence downstream of the puromycin gene
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMig (Martins Lab) was a gift from L. Miguel Martins (Addgene plasmid # 14125 ; http://n2t.net/addgene:14125 ; RRID:Addgene_14125) -
For your References section:
Involvement of MINK, a Ste20 family kinase, in Ras oncogene-induced growth arrest in human ovarian surface epithelial cells. Nicke B, Bastien J, Khanna SJ, Warne PH, Cowling V, Cook SJ, Peters G, Delpuech O, Schulze A, Berns K, Mullenders J, Beijersbergen RL, Bernards R, Ganesan TS, Downward J, Hancock DC. Mol Cell. 2005 Dec 9. 20(5):673-85. 10.1016/j.molcel.2005.10.038 PubMed 16337592