Skip to main content

pMig (Martins Lab)
(Plasmid #14125)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 14125 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRetroSuper
  • Backbone size w/o insert (bp) 6349
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    IRES-EGFP
  • Insert Size (bp)
    1310
  • Mutation
    Cla I sites were silenced in the original pRetroSuper vector

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (unknown if destroyed)
  • 3′ cloning site ClaI (unknown if destroyed)
  • 5′ sequencing primer CGTGCGCCCTGGCAGGAAGATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid expresses EGFP from an IRES sequence downstream of the puromycin gene

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMig (Martins Lab) was a gift from L. Miguel Martins (Addgene plasmid # 14125 ; http://n2t.net/addgene:14125 ; RRID:Addgene_14125)
  • For your References section:

    Involvement of MINK, a Ste20 family kinase, in Ras oncogene-induced growth arrest in human ovarian surface epithelial cells. Nicke B, Bastien J, Khanna SJ, Warne PH, Cowling V, Cook SJ, Peters G, Delpuech O, Schulze A, Berns K, Mullenders J, Beijersbergen RL, Bernards R, Ganesan TS, Downward J, Hancock DC. Mol Cell. 2005 Dec 9. 20(5):673-85. 10.1016/j.molcel.2005.10.038 PubMed 16337592