Skip to main content

pROSA26-CreERT2
(Plasmid #149437)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 149437 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pROSA26-TG
  • Backbone manufacturer
    Liqun Luo Lab (Addgene Plasmid #40026)
  • Backbone size w/o insert (bp) 14486
  • Total vector size (bp) 15259
  • Vector type
    Mammalian Expression, Mouse Targeting, Cre/Lox
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cre-ERT2 fusion protein
  • Alt name
    inducible Cre
  • Species
    Synthetic
  • Insert Size (bp)
    4669
  • Promoter CAG promoter
  • Tag / Fusion Protein
    • ERT2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer pCAG-F
  • 3′ sequencing primer ACGCCCACACACCAGGTTAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Connie Cepko Lab: pCAG-CreERT2 (Addgene Plasmid #14797)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pROSA26-CreERT2 was a gift from Primo Schaer (Addgene plasmid # 149437 ; http://n2t.net/addgene:149437 ; RRID:Addgene_149437)
  • For your References section:

    Inducible TDG knockout models to study epigenetic regulation. Schwarz SD, Grundbacher E, Hrovat AM, Xu J, Kusnierczyk A, Vagbo CB, Schar P, Schuermann D. F1000Res. 2020 Sep 9;9:1112. doi: 10.12688/f1000research.25637.2. eCollection 2020. 10.12688/f1000research.25637.2 PubMed 33082936