pROSA26-ERT2CreERT2
(Plasmid #149436)

• Purpose: ROSA26 targetting vector with tamoxifen-inducible Cre recombinase
• Depositing Lab: Primo Schaer
• Publication: Schwarz et al F1000Res. 2020 Sep 9;9:1112. doi: 10.12688/f1000research.25637.2. eCollection 2020.

Backbone

• Vector backbone: pROSA26-TG
• Backbone manufacturer: Liqun Luo Lab (Addgene Plasmid #40026)
• Backbone size w/o insert (bp): 14483
• Total vector size (bp): 16206
• Vector type: Mammalian Expression, Mouse Targeting, Cre/Lox
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ERT2-Cre-ERT2 fusion protein
• Alt name: inducible Cre
• Species: Synthetic
• Insert Size (bp): 4669
• Promoter: CAG promoter
• Tags / Fusion Proteins:
  • ERT2 (N terminal on insert)
  • ERT2 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: pCAG-F
• 3′ sequencing primer: ACGCCCACACACCAGGTTAG

Resource Information

• Supplemental Documents:
  • pROSA26-ERT2CreERT2.gbk
• A portion of this plasmid was derived from a plasmid made by: Connie Cepko Lab: pCAG-ERT2CreERT2 (Addgene Plasmid #13777)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry