pCHA1.1-MFSD12-V5
(Plasmid
#149508)
-
PurposeStable expression of human MFSD12 with recoded nucleotide sequence.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 149508 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCHA1.1
- Backbone size w/o insert (bp) 7994
-
Vector typeLentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMFSD12
-
Alt nameC19orf28
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1440
-
MutationCodon Optimized Sequence
-
Entrez GeneMFSD12 (a.k.a. C19orf28, PP3501)
- Promoter Ubc
-
Tag
/ Fusion Protein
- V5 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer tgaagctccggttttgaact
- 3′ sequencing primer ctgctgtccctgtaataaacccg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCHA1.1-MFSD12-V5 was a gift from David Sabatini (Addgene plasmid # 149508 ; http://n2t.net/addgene:149508 ; RRID:Addgene_149508) -
For your References section:
MFSD12 mediates the import of cysteine into melanosomes and lysosomes. Adelmann CH, Traunbauer AK, Chen B, Condon KJ, Chan SH, Kunchok T, Lewis CA, Sabatini DM. Nature. 2020 Nov 18. pii: 10.1038/s41586-020-2937-x. doi: 10.1038/s41586-020-2937-x. 10.1038/s41586-020-2937-x PubMed 33208952