Skip to main content

pSH1/Mf-del-Akt-E
(Plasmid #15288)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 15288 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSH1
  • Backbone manufacturer
    GR Crabtree lab
  • Backbone size w/o insert (bp) 3500
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    delPH-Akt
  • Alt name
    PKB
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1240
  • Mutation
    Truncated PH (residues 1-99)
  • Entrez Gene
    Akt1 (a.k.a. Akt, LTR-akt, PKB, PKB/Akt, PKBalpha, Rac)
  • Tags / Fusion Proteins
    • HA epitope (C terminal on insert)
    • Myristoylation-targeting domain Fyn (16aa) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI, SacII (not destroyed)
  • 3′ cloning site EcoRI, BamHI (not destroyed)
  • 5′ sequencing primer gaggtgttacttctgctctaaaagc
  • 3′ sequencing primer cactgcattctagttgtggtttg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSH1/Mf-del-Akt-E was a gift from David Spencer (Addgene plasmid # 15288 ; http://n2t.net/addgene:15288 ; RRID:Addgene_15288)
  • For your References section:

    An essential role for Akt1 in dendritic cell function and tumor immunotherapy. Park D, Lapteva N, Seethammagari M, Slawin KM, Spencer DM. Nat Biotechnol. 2006 Dec . 24(12):1581-90. 10.1038/nbt1262 PubMed 17143278