pCgsgRNA_crtYf
(Plasmid
#153338)
-
PurposeDouble-plasmid-based CRISPR-Cas9 system in Corynebacterium glutamicum; rep oriVC. glutamicum; pMB1 oriVE. Coli; Pj23119-crRNA targeting crtYf; Spcr
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 153338 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJYS2_crtYf
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecrRNA targeting crtYf
-
gRNA/shRNA sequencectgcgtttaaacatatttcc
-
SpeciesOther
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer unknown (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCgsgRNA_crtYf was a gift from Sheng Yang (Addgene plasmid # 153338 ; http://n2t.net/addgene:153338 ; RRID:Addgene_153338) -
For your References section:
De Novo Engineering of Corynebacterium glutamicum for l-Proline Production. Zhang J, Qian F, Dong F, Wang Q, Yang J, Jiang Y, Yang S. ACS Synth Biol. 2020 Jul 17;9(7):1897-1906. doi: 10.1021/acssynbio.0c00249. Epub 2020 Jul 6. 10.1021/acssynbio.0c00249 PubMed 32627539