pMG035 MBP-Axin∆BCD-His
(Plasmid
#154053)
-
PurposeExpresses MBP-Axin∆BCD-His (human Axin with aa465-518 deletion as a fusion protein with MBP and His- tags) in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMBP-MG
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 6716
- Total vector size (bp) 9194
-
Modifications to backboneModified to include an N-terminal TEV-cleavable MBP tag and a C-terminal His6 tag
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAxin1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2316
-
GenBank IDBC000251
-
Entrez GeneAXIN1 (a.k.a. AXIN, PPP1R49)
- Promoter Tac
-
Tags
/ Fusion Proteins
- MBP (N terminal on backbone)
- His6 (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer MalE Forward GGTCGTCAGACTGTCGATGAAGCC
- 3′ sequencing primer M13F Reverse TGTAAAACGACGGCCAGT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDerived from hAxin1-rLuc, a gift from Randall Moon
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMG035 MBP-Axin∆BCD-His was a gift from Jesse Zalatan (Addgene plasmid # 154053 ; http://n2t.net/addgene:154053 ; RRID:Addgene_154053) -
For your References section:
The Scaffold Protein Axin Promotes Signaling Specificity within the Wnt Pathway by Suppressing Competing Kinase Reactions. Gavagan M, Fagnan E, Speltz EB, Zalatan JG. Cell Syst. 2020 Jun 24;10(6):515-525.e5. doi: 10.1016/j.cels.2020.05.002. Epub 2020 Jun 17. 10.1016/j.cels.2020.05.002 PubMed 32553184