Skip to main content

pEF019 MBP-β-catenin-His
(Plasmid #154070)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154070 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMBP-MG
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 6716
  • Total vector size (bp) 9059
  • Modifications to backbone
    Modified to include an N-terminal TEV-cleavable MBP tag and a C-terminal His6 tag
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CTNNB1
  • Alt name
    β-catenin
  • Alt name
    Beta-catenin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2343
  • GenBank ID
    AY463360
  • Entrez Gene
    CTNNB1 (a.k.a. CTNNB, EVR7, MRD19, NEDSDV, armadillo)
  • Promoter Tac
  • Tags / Fusion Proteins
    • MBP (N terminal on backbone)
    • His6 (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer MalE Forward GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer M13F Reverse TGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene #14753

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF019 MBP-β-catenin-His was a gift from Jesse Zalatan (Addgene plasmid # 154070 ; http://n2t.net/addgene:154070 ; RRID:Addgene_154070)
  • For your References section:

    The Scaffold Protein Axin Promotes Signaling Specificity within the Wnt Pathway by Suppressing Competing Kinase Reactions. Gavagan M, Fagnan E, Speltz EB, Zalatan JG. Cell Syst. 2020 Jun 24;10(6):515-525.e5. doi: 10.1016/j.cels.2020.05.002. Epub 2020 Jun 17. 10.1016/j.cels.2020.05.002 PubMed 32553184