Skip to main content

XLone-BSD SARS-CoV2 N P2A mCherry
(Plasmid #154398)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154398 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    XLone-GFP Addgene #96930
  • Backbone manufacturer
    Xiaojun Lian Lab
  • Backbone size w/o insert (bp) 5599
  • Total vector size (bp) 7714
  • Vector type
    Mammalian Expression ; Piggybac
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV2 N Protein
  • Alt name
    Nucleocapsid
  • Species
    SARS-CoV2
  • Insert Size (bp)
    1275
  • Entrez Gene
    N (a.k.a. GU280_gp10)
  • Promoter TRE3G
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NheI or SpeI (not destroyed)
  • 5′ sequencing primer gcgcctataaaagagtgctga
  • 3′ sequencing primer M13 FWD
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    SARS-CoV-2-N was PCR amplified from Addgene plasmid #141391, gift from Dr. Nevan Krogan lab.

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    XLone-BSD SARS-CoV2 N P2A mCherry was a gift from Xiaoping Bao (Addgene plasmid # 154398 ; http://n2t.net/addgene:154398 ; RRID:Addgene_154398)