XLone-BSD SARS-CoV2 N P2A mCherry
(Plasmid
#154398)
-
PurposePiggybacTransposon-based tunable and temporal expression control of SARS-CoV2 N and mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154398 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneXLone-GFP Addgene #96930
-
Backbone manufacturerXiaojun Lian Lab
- Backbone size w/o insert (bp) 5599
- Total vector size (bp) 7714
-
Vector typeMammalian Expression ; Piggybac
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV2 N Protein
-
Alt nameNucleocapsid
-
SpeciesSARS-CoV2
-
Insert Size (bp)1275
-
Entrez GeneN (a.k.a. GU280_gp10)
- Promoter TRE3G
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NheI or SpeI (not destroyed)
- 5′ sequencing primer gcgcctataaaagagtgctga
- 3′ sequencing primer M13 FWD (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySARS-CoV-2-N was PCR amplified from Addgene plasmid #141391, gift from Dr. Nevan Krogan lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
XLone-BSD SARS-CoV2 N P2A mCherry was a gift from Xiaoping Bao (Addgene plasmid # 154398 ; http://n2t.net/addgene:154398 ; RRID:Addgene_154398)