Skip to main content
Addgene

pLX303-ABI1-dCas9
(Plasmid #154474)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154474 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLX303
  • Backbone manufacturer
    David Root lab; Addgene plasmid #25897
  • Total vector size (bp) 12879
  • Modifications to backbone
    Added dCas9 to the 3' end of the Gateway cloning cassette
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Grow at 30 degrees to avoid recombination
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ABI1
  • Species
    A. thaliana (mustard weed)
  • Mutation
    Includes ABI1 aa 126-423, D143A
  • Entrez Gene
    ABI1 (a.k.a. AT4G26080, ABA INSENSITIVE 1, AtABI1, F20B18.190, F20B18_190, PROTEIN PHOSPHATASE 2C ABI1)
  • Promoter CMV

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX303-ABI1-dCas9 was a gift from Mikko Taipale (Addgene plasmid # 154474 ; http://n2t.net/addgene:154474 ; RRID:Addgene_154474)
  • For your References section:

    An efficient KRAB domain for CRISPRi applications in human cells. Alerasool N, Segal D, Lee H, Taipale M. Nat Methods. 2020 Nov;17(11):1093-1096. doi: 10.1038/s41592-020-0966-x. Epub 2020 Oct 5. 10.1038/s41592-020-0966-x PubMed 33020655