-
PurposeEpisomally expresses KDM4D and GLIS1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154880 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCE
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer cgcggggggacggctgc
- 3′ sequencing primer ctattgcaatgaaaataaatttcctttatt
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCE-KdGl was a gift from Hideyuki Okano (Addgene plasmid # 154880 ; http://n2t.net/addgene:154880 ; RRID:Addgene_154880) -
For your References section:
Non-viral Induction of Transgene-free iPSCs from Somatic Fibroblasts of Multiple Mammalian Species. Yoshimatsu S, Nakajima M, Iguchi A, Sanosaka T, Sato T, Nakamura M, Nakajima R, Arai E, Ishikawa M, Imaizumi K, Watanabe H, Okahara J, Noce T, Takeda Y, Sasaki E, Behr R, Edamura K, Shiozawa S, Okano H. Stem Cell Reports. 2021 Mar 23. pii: S2213-6711(21)00132-6. doi: 10.1016/j.stemcr.2021.03.002. 10.1016/j.stemcr.2021.03.002 PubMed 33798453