BRD4 CRISPRi plasmid
(Plasmid
#154890)
-
PurposeHuman BRD4 CRISPRi gRNA
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154890 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonesgOpti
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBRD4-targeting gRNA
-
gRNA/shRNA sequenceGCGGCTGCCGGCGGTGCCCG
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mitra Lab accession number: pRM1889
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BRD4 CRISPRi plasmid was a gift from Joseph Dougherty & Rob Mitra (Addgene plasmid # 154890 ; http://n2t.net/addgene:154890 ; RRID:Addgene_154890) -
For your References section:
Self-Reporting Transposons Enable Simultaneous Readout of Gene Expression and Transcription Factor Binding in Single Cells. Moudgil A, Wilkinson MN, Chen X, He J, Cammack AJ, Vasek MJ, Lagunas T Jr, Qi Z, Lalli MA, Guo C, Morris SA, Dougherty JD, Mitra RD. Cell. 2020 Aug 20;182(4):992-1008.e21. doi: 10.1016/j.cell.2020.06.037. Epub 2020 Jul 24. 10.1016/j.cell.2020.06.037 PubMed 32710817