- 
            PurposeLentiviral vector encoding Rfx Cas13d fused with 2xNLS, 3xFLAG, and 2A-tagged mCherry.
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155305 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepHR
 - Backbone size w/o insert (bp) 9735
 - Total vector size (bp) 13551
 - 
              Vector typeMammalian Expression, Lentiviral
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)NEB Stable
 - 
              Growth instructionsIt may take up to 2 days for bacteria containing this plasmid to grow well on plates or in liquid culture
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert namemCherry 2A-tagged to Ruminococcus flavefaciens XPD3002 Cas13d
 - 
                  Alt nameRfxCas13d
 - 
                  Alt nameCasRx
 - 
                    SpeciesSynthetic
 - 
                  Insert Size (bp)3816
 - Promoter EF1a
 - 
    
        Tag
        / Fusion Protein
    
- 2xNLS-3xFLAG (C terminal on insert)
 
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
 - 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 - 
            
            
            Addgene Notes
 - 
            Articles Citing this Plasmid
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pSLQ5428_pHR_EF1a-mCherry-P2A-Rfx_Cas13d-2xNLS-3xFLAG was a gift from Stanley Qi (Addgene plasmid # 155305 ; http://n2t.net/addgene:155305 ; RRID:Addgene_155305) - 
                
For your References section:
Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and Influenza. Abbott TR, Dhamdhere G, Liu Y, Lin X, Goudy L, Zeng L, Chemparathy A, Chmura S, Heaton NS, Debs R, Pande T, Endy D, La Russa MF, Lewis DB, Qi LS. Cell. 2020 May 14;181(4):865-876.e12. doi: 10.1016/j.cell.2020.04.020. Epub 2020 Apr 29. 10.1016/j.cell.2020.04.020 PubMed 32353252