Skip to main content
Addgene

pSLQ5465_pHR_hU6-crScaffold_EF1a-PuroR-T2A-BFP
(Plasmid #155307)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155307 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Backbone size w/o insert (bp) 5827
  • Total vector size (bp) 8792
  • Modifications to backbone
    Removed BbsI sites from WPRE and downstream by mutation.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rfx Cas13d CRISPR RNA puromycin resistance 2A-tagged BFP
  • Alt name
    Rfx Cas13d crRNA
  • Alt name
    PuroR
  • gRNA/shRNA sequence
    n/a
  • Species
    Synthetic
  • Promoter hU6, EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Clone new guides by digesting with BbsI, then annealing, ligating oligos containing the spacer of interest.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ5465_pHR_hU6-crScaffold_EF1a-PuroR-T2A-BFP was a gift from Stanley Qi (Addgene plasmid # 155307 ; http://n2t.net/addgene:155307 ; RRID:Addgene_155307)
  • For your References section:

    Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and Influenza. Abbott TR, Dhamdhere G, Liu Y, Lin X, Goudy L, Zeng L, Chemparathy A, Chmura S, Heaton NS, Debs R, Pande T, Endy D, La Russa MF, Lewis DB, Qi LS. Cell. 2020 May 14;181(4):865-876.e12. doi: 10.1016/j.cell.2020.04.020. Epub 2020 Apr 29. 10.1016/j.cell.2020.04.020 PubMed 32353252