-
PurposeRfx Cas13d guide cloning lentiviral vector with constitutively expressed puromycin resistance 2A-tagged with tagBFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155307 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
- Backbone size w/o insert (bp) 5827
- Total vector size (bp) 8792
-
Modifications to backboneRemoved BbsI sites from WPRE and downstream by mutation.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRfx Cas13d CRISPR RNA puromycin resistance 2A-tagged BFP
-
Alt nameRfx Cas13d crRNA
-
Alt namePuroR
-
gRNA/shRNA sequencen/a
-
SpeciesSynthetic
- Promoter hU6, EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Clone new guides by digesting with BbsI, then annealing, ligating oligos containing the spacer of interest.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ5465_pHR_hU6-crScaffold_EF1a-PuroR-T2A-BFP was a gift from Stanley Qi (Addgene plasmid # 155307 ; http://n2t.net/addgene:155307 ; RRID:Addgene_155307) -
For your References section:
Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and Influenza. Abbott TR, Dhamdhere G, Liu Y, Lin X, Goudy L, Zeng L, Chemparathy A, Chmura S, Heaton NS, Debs R, Pande T, Endy D, La Russa MF, Lewis DB, Qi LS. Cell. 2020 May 14;181(4):865-876.e12. doi: 10.1016/j.cell.2020.04.020. Epub 2020 Apr 29. 10.1016/j.cell.2020.04.020 PubMed 32353252