CRY2olig-BFP
(Plasmid
#155355)
-
PurposeLentivector to express CRY2olig-BFP control
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFUGW
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecry2olig-BFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer UBC: GTGAGGCGTCAGTTTCTTTG
- 3′ sequencing primer CGGAAAGGAGCTGACAGGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CRY2olig-BFP was a gift from Xiaowei Zhuang (Addgene plasmid # 155355 ; http://n2t.net/addgene:155355 ; RRID:Addgene_155355) -
For your References section:
m(6)A-binding YTHDF proteins promote stress granule formation. Fu Y, Zhuang X. Nat Chem Biol. 2020 May 25. pii: 10.1038/s41589-020-0524-y. doi: 10.1038/s41589-020-0524-y. 10.1038/s41589-020-0524-y PubMed 32451507