Skip to main content

pU6-PspCas13b-gRNA-Actb1216
(Plasmid #155368)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155368 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pU6 with pBR222 origin
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PspCas13b gRNA targeting Actb 1216
  • gRNA/shRNA sequence
    GAAGCATTTGCGGTGGACGATGGAGGGGCC
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-PspCas13b-gRNA-Actb1216 was a gift from David Liu (Addgene plasmid # 155368 ; http://n2t.net/addgene:155368 ; RRID:Addgene_155368)
  • For your References section:

    Programmable m(6)A modification of cellular RNAs with a Cas13-directed methyltransferase. Wilson C, Chen PJ, Miao Z, Liu DR. Nat Biotechnol. 2020 Jun 29. pii: 10.1038/s41587-020-0572-6. doi: 10.1038/s41587-020-0572-6. 10.1038/s41587-020-0572-6 PubMed 32601430