-
PurposePspCas13b guide RNA positioned 8bp 5' of Actb 1216 for targeted m6A RNA methylation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155368 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepU6 with pBR222 origin
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePspCas13b gRNA targeting Actb 1216
-
gRNA/shRNA sequenceGAAGCATTTGCGGTGGACGATGGAGGGGCC
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-PspCas13b-gRNA-Actb1216 was a gift from David Liu (Addgene plasmid # 155368 ; http://n2t.net/addgene:155368 ; RRID:Addgene_155368) -
For your References section:
Programmable m(6)A modification of cellular RNAs with a Cas13-directed methyltransferase. Wilson C, Chen PJ, Miao Z, Liu DR. Nat Biotechnol. 2020 Jun 29. pii: 10.1038/s41587-020-0572-6. doi: 10.1038/s41587-020-0572-6. 10.1038/s41587-020-0572-6 PubMed 32601430