pAAV.CMV.SV40.THBS1-HA-KDEL.SV40(polyA)
(Plasmid
#156164)
-
PurposeExpresses murine Thrombospondin-1 (THBS1) protein with HA-tag at C-terminus and KDEL (ER retention) sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 156164 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneModified pAAV-MCS
- Backbone size w/o insert (bp) 3601
- Total vector size (bp) 7162
-
Modifications to backboneTruncated CMV enhancer sequence; beta-Globine intron replaced with SV40 intron; hGH polyA signal replaced with SV40 polyA signal
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameThrombospondin-1
-
Alt nameTHBS1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3561
-
MutationTHBS1 with addition of ER-retention sequence KDEL
-
Entrez GeneThbs1 (a.k.a. TSP-1, TSP1, Thbs-1, tbsp1)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CCTCCCCCTGAACCTGAAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV.CMV.SV40.THBS1-HA-KDEL.SV40(polyA) was a gift from Kevin Park (Addgene plasmid # 156164 ; http://n2t.net/addgene:156164 ; RRID:Addgene_156164) -
For your References section:
Thrombospondin-1 Mediates Axon Regeneration in Retinal Ganglion Cells. Bray ER, Yungher BJ, Levay K, Ribeiro M, Dvoryanchikov G, Ayupe AC, Thakor K, Marks V, Randolph M, Danzi MC, Schmidt TM, Chaudhari N, Lemmon VP, Hattar S, Park KK. Neuron. 2019 Aug 21;103(4):642-657.e7. doi: 10.1016/j.neuron.2019.05.044. Epub 2019 Jun 26. 10.1016/j.neuron.2019.05.044 PubMed 31255486