pETduet-1:MCS1(HemeOxygenase)::MCS2(ReBphP-PCM)
(Plasmid
#156463)
-
PurposeExpress Heme Oxygenase (Nostocaceae) and ReBphP-PCM
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 156463 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-Duet1
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 7620
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameHeme Oxygenase
-
Alt nameHO
-
Alt namebiliverdin-producing
-
SpeciesNostocaceae
-
Insert Size (bp)723
-
GenBank IDBAB73596.1
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Nco1 (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer aaaccatggatggcgatgagc
- 3′ sequencing primer aaactgcagttactcagcagtggc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameReBphP-PCM
-
Alt nameReBphP
-
SpeciesRhizobium etli
-
Insert Size (bp)1572
- Promoter T7
-
Tag
/ Fusion Protein
- His Tag (C terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Nde1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer aaacatatgagcggcaccagag
- 3′ sequencing primer aaactgatcgccgagctgaacCATCATCACCATCACCACTAA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ReBphP was synthesized as gene strings (GeneArt, Life Technologies, Regensburg, Germany) and then cloned in MCS2 of pETDuet1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETduet-1:MCS1(HemeOxygenase)::MCS2(ReBphP-PCM) was a gift from Andre Stiel (Addgene plasmid # 156463 ; http://n2t.net/addgene:156463 ; RRID:Addgene_156463) -
For your References section:
Multiplexed whole-animal imaging with reversibly switchable optoacoustic proteins. Mishra K, Stankevych M, Fuenzalida-Werner JP, Grassmann S, Gujrati V, Huang Y, Klemm U, Buchholz VR, Ntziachristos V, Stiel AC. Sci Adv. 2020 Jun 12;6(24):eaaz6293. doi: 10.1126/sciadv.aaz6293. eCollection 2020 Jun. 10.1126/sciadv.aaz6293 PubMed 32582850