pETduet-1:MCS1(HemeOxygenase)::MCS2(ReBphP-PCM)
(Plasmid #156463)

• Purpose: Express Heme Oxygenase (Nostocaceae) and ReBphP-PCM
• Depositing Lab: Andre Stiel
• Publication: Mishra et al Sci Adv. 2020 Jun 12;6(24):eaaz6293. doi: 10.1126/sciadv.aaz6293. eCollection 2020 Jun.

Backbone

• Vector backbone: pET-Duet1
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5420
• Total vector size (bp): 7620
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Heme Oxygenase
• Alt name: HO
• Alt name: biliverdin-producing
• Species: Nostocaceae
• Insert Size (bp): 723
• GenBank ID: BAB73596.1
• Promoter: T7

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nco1 (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: aaaccatggatggcgatgagc
• 3′ sequencing primer: aaactgcagttactcagcagtggc

Gene/Insert 2

• Gene/Insert name: ReBphP-PCM
• Alt name: ReBphP
• Species: Rhizobium etli
• Insert Size (bp): 1572
• Promoter: T7
• Tag / Fusion Protein:
  • His Tag (C terminal on backbone)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nde1 (not destroyed)
• 3′ cloning site: Xho1 (not destroyed)
• 5′ sequencing primer: aaacatatgagcggcaccagag
• 3′ sequencing primer: aaactgatcgccgagctgaacCATCATCACCATCACCACTAA

Resource Information

• Supplemental Documents:
  • pET-Duet1_MCS1(HemeOxygenase)_MCS2(ReBphP-PCM).gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

ReBphP was synthesized as gene strings (GeneArt, Life Technologies, Regensburg, Germany) and then cloned in MCS2 of pETDuet1