pmCherry C1 MFF
              
              
                (Plasmid
                
                #157760)
              
            
            
            
          - 
            PurposeExpression of mcherry:MFF in cells
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 157760 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepmCherry-C1
- 
              Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4722
- 
              Vector typeMammalian Expression
- 
                Selectable markersNeomycin (select with G418)
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameMFF
- 
                    SpeciesH. sapiens (human)
- 
                        Entrez GeneMFF (a.k.a. C2orf33, EMPF2, GL004)
- Promoter CMV
- 
    
        Tag
        / Fusion Protein
    - mCherry (N terminal on insert)
 
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAAATTTGTGATGCTATTGC
- 3′ sequencing primer SV40pA-R (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pmCherry C1 MFF was a gift from Marc Tramier (Addgene plasmid # 157760 ; http://n2t.net/addgene:157760 ; RRID:Addgene_157760)
- 
                For your References section: Aurora kinase A localises to mitochondria to control organelle dynamics and energy production. Bertolin G, Bulteau AL, Alves-Guerra MC, Burel A, Lavault MT, Gavard O, Le Bras S, Gagne JP, Poirier GG, Le Borgne R, Prigent C, Tramier M. eLife. 2018 Aug 2;7. pii: 38111. doi: 10.7554/eLife.38111. 10.7554/eLife.38111 PubMed 30070631
 
    
