61426-hU6-shmFmr1-EF1a-mCherry
(Plasmid
#157859)
-
PurposeExpresses a shRNA targeting mouse Fmr1 gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157859 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAddgene #61426
- Backbone size w/o insert (bp) 11736
- Total vector size (bp) 10239
-
Modifications to backbonereplacing inserts with shRNA-EF1a-mCherry
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFmr1
-
gRNA/shRNA sequencecgcaccaagttgtctcttata
-
SpeciesM. musculus (mouse)
-
Entrez GeneFmr1 (a.k.a. FMRP, Fmr-1)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
61426-hU6-shmFmr1-EF1a-mCherry was a gift from Xinyu Zhao (Addgene plasmid # 157859 ; http://n2t.net/addgene:157859 ; RRID:Addgene_157859) -
For your References section:
Reduced mitochondrial fusion and Huntingtin levels contribute to impaired dendritic maturation and behavioral deficits in Fmr1-mutant mice. Shen M, Wang F, Li M, Sah N, Stockton ME, Tidei JJ, Gao Y, Korabelnikov T, Kannan S, Vevea JD, Chapman ER, Bhattacharyya A, van Praag H, Zhao X. Nat Neurosci. 2019 Mar;22(3):386-400. doi: 10.1038/s41593-019-0338-y. Epub 2019 Feb 11. 10.1038/s41593-019-0338-y PubMed 30742117