Skip to main content

pJDC122
(Plasmid #157876)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157876 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJDC89
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    tdTomato

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site ScaI (unknown if destroyed)
  • 5′ sequencing primer AGGAGGATAACATATGGAAGATGC
  • 3′ sequencing primer CAGCTTCGACTTGCCTCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Dr. Rodger Y. Tsien

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJDC122 was a gift from Jeffrey Cirillo (Addgene plasmid # 157876 ; http://n2t.net/addgene:157876 ; RRID:Addgene_157876)
  • For your References section:

    Application of Fluorescent Protein Expressing Strains to Evaluation of Anti-Tuberculosis Therapeutic Efficacy In Vitro and In Vivo. Kong Y, Yang D, Cirillo SL, Li S, Akin A, Francis KP, Maloney T, Cirillo JD. PLoS One. 2016 Mar 2;11(3):e0149972. doi: 10.1371/journal.pone.0149972. eCollection 2016. 10.1371/journal.pone.0149972 PubMed 26934495