-
Purposeexpresses ratiometric sensor of lysosomal lumenal pH
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157940 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameR2pH-LAMP1-3xFLAG
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2745
-
GenBank IDNM_001317353.1:229-1452
-
Entrez GeneLamp1 (a.k.a. CD107a, LGP-120, LGP-A, Lamp-1, P2B, Perk)
- Promoter Chick beta actin pomoter
-
Tags
/ Fusion Proteins
- mCherry
- pHluorin
- 3XFLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer CCAGAAGTCAGATGCTCAAGGGGTTT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG R2pH-LAMP1-3xFLAG was a gift from Massimiliano Stagi (Addgene plasmid # 157940 ; http://n2t.net/addgene:157940 ; RRID:Addgene_157940) -
For your References section:
Live imaging of intra-lysosome pH in cell lines and primary neuronal culture using a novel genetically encoded biosensor. Ponsford AH, Ryan TA, Raimondi A, Cocucci E, Wycislo SA, Frohlich F, Swan LE, Stagi M. Autophagy. 2020 Jun 9:1-19. doi: 10.1080/15548627.2020.1771858. 10.1080/15548627.2020.1771858 PubMed 32515674