Lenti-117G-hyeA3A-BE4max
(Plasmid
#157946)
-
PurposeLentiviral expression of hyeA3A-BE4max
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 157946 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAdapted from lentiCRISPRv1
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLenti -117G-hyeA3A-BE4max
-
SpeciesSynthetic
-
MutationN57G
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgcagacaaatggcagta
- 3′ sequencing primer TTAAGAATACCAGTCAATCTTTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-117G-hyeA3A-BE4max was a gift from Dali Li (Addgene plasmid # 157946 ; http://n2t.net/addgene:157946 ; RRID:Addgene_157946) -
For your References section:
Increasing the efficiency and targeting range of cytidine base editors through fusion of a single-stranded DNA-binding protein domain. Zhang X, Chen L, Zhu B, Wang L, Chen C, Hong M, Huang Y, Li H, Han H, Cai B, Yu W, Yin S, Yang L, Yang Z, Liu M, Zhang Y, Mao Z, Wu Y, Liu M, Li D. Nat Cell Biol. 2020 Jun;22(6):740-750. doi: 10.1038/s41556-020-0518-8. Epub 2020 May 11. 10.1038/s41556-020-0518-8 PubMed 32393889