pCAG-TET3G-T2A-Puro
(Plasmid
#158067)
-
PurposeEncodes the Tet3G transactivator and puromycin resistance.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158067 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX459
- Backbone size w/o insert (bp) 4906
- Total vector size (bp) 5650
-
Modifications to backboneDeletion of Cas9 gene and replacing by TET3G gene Swap of Promoter - chicken β-actin promoter
-
Vector typeMammalian Expression, AAV
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepCAG-TET3G-T2A-Puro
-
Alt nameTet transactivator
-
SpeciesSynthetic
-
Insert Size (bp)1413
- Promoter pCAG
-
Tag
/ Fusion Protein
- puromycin reistance gene (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggctgtaattagctgagcaagagg
- 3′ sequencing primer cgtgggcttgtactcggtc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-TET3G-T2A-Puro was a gift from Adolfo Rivero-Muller (Addgene plasmid # 158067 ; http://n2t.net/addgene:158067 ; RRID:Addgene_158067) -
For your References section:
An Improved Vector System for Homogeneous and Stable Gene Regulation. Michalec-Wawiorka B, Czapinski J, Filipek K, Rulak P, Czerwonka A, Tchorzewski M, Rivero-Muller A. Int J Mol Sci. 2021 May 14;22(10). pii: ijms22105206. doi: 10.3390/ijms22105206. 10.3390/ijms22105206 PubMed 34069024