pHR SFFV GLP1R(S301A)-EGFP
(Plasmid #158123)

• Purpose: Lentiviral plasmid for expression of GLP1R(S301)-EGFP fusion with SFFV promoter.
• Depositing Lab: Neal Devaraj
• Publication: Misc Unpublished Plasmids (unpublished)

Backbone

• Vector backbone: pHR_SFFV
• Backbone size w/o insert (bp): 9033
• Total vector size (bp): 11191
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GLP1R
• Alt name: GLP1R(S301A)
• Mutation: Serine 301 changed to alanine to enhance membrane localization.
• Entrez Gene: GLP1R (a.k.a. GLP-1, GLP-1-R, GLP-1R)
• Promoter: SFFV
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: attctcacgcgtcaagtggag
• 3′ sequencing primer: GCAGGTCGACTCTAGAGTCGC

Resource Information

• Supplemental Documents:
  • pHR SFFV GLP1R(S301A)-EGFP.gb
• A portion of this plasmid was derived from a plasmid made by: From the Brian Roth Lab: https://www.addgene.org/66295/

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The pHR_SFFV backbone is from the Wendell Lim Lab (Morsut et al Cell. 2016 Feb 11;164(4):780-91. doi: 10.1016/j.cell.2016.01.012. Epub 2016 Jan 28.) https://www.addgene.org/79121/

The GLP1R gene is from from the Brian Roth Lab (Kroeze et al Nat Struct Mol Biol. 2015 May;22(5):362-9. doi: 10.1038/nsmb.3014. Epub 2015 Apr 20.) https://www.addgene.org/66295/