Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHR SFFV GLP1R(S301A)-EGFP
(Plasmid #158123)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158123 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHR_SFFV
  • Backbone size w/o insert (bp) 9033
  • Total vector size (bp) 11191
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GLP1R
  • Alt name
    GLP1R(S301A)
  • Mutation
    Serine 301 changed to alanine to enhance membrane localization.
  • Entrez Gene
    GLP1R (a.k.a. GLP-1, GLP-1-R, GLP-1R)
  • Promoter SFFV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer attctcacgcgtcaagtggag
  • 3′ sequencing primer GCAGGTCGACTCTAGAGTCGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    From the Brian Roth Lab: https://www.addgene.org/66295/

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The pHR_SFFV backbone is from the Wendell Lim Lab (Morsut et al Cell. 2016 Feb 11;164(4):780-91. doi: 10.1016/j.cell.2016.01.012. Epub 2016 Jan 28.) https://www.addgene.org/79121/

The GLP1R gene is from from the Brian Roth Lab (Kroeze et al Nat Struct Mol Biol. 2015 May;22(5):362-9. doi: 10.1038/nsmb.3014. Epub 2015 Apr 20.) https://www.addgene.org/66295/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR SFFV GLP1R(S301A)-EGFP was a gift from Neal Devaraj (Addgene plasmid # 158123 ; http://n2t.net/addgene:158123 ; RRID:Addgene_158123)