pXPR_502_sgCD45
(Plasmid
#158705)
-
PurposeCD45 CRISPRa control
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158705 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepXPR
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD45
-
Alt namePTPRC
-
gRNA/shRNA sequenceGTTGTTCTAAGTCAGTAGAA
-
SpeciesH. sapiens (human)
-
Entrez GenePTPRC (a.k.a. B220, CD45, CD45R, GP180, IMD105, L-CA, LCA, LY5, T200)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For questions regarding use of this plasmid, please contact John Doench.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXPR_502_sgCD45 was a gift from John Doench & David Root (Addgene plasmid # 158705 ; http://n2t.net/addgene:158705 ; RRID:Addgene_158705) -
For your References section:
Identification of Antinorovirus Genes in Human Cells Using Genome-Wide CRISPR Activation Screening. Orchard RC, Sullender ME, Dunlap BF, Balce DR, Doench JG, Virgin HW. J Virol. 2018 Dec 10;93(1). pii: JVI.01324-18. doi: 10.1128/JVI.01324-18. Print 2019 Jan 1. 10.1128/JVI.01324-18 PubMed 30305350