-
PurposeFor cloning and constitutive expression of crRNAs in mycobacterium
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158708 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSL001
-
Backbone manufacturerfrom Houhui Song's Lab
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology ; Mycobacteria Expression
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecrRNA
-
gRNA/shRNA sequencegtctaagaactttaaataatttctactgttgtagattccgtctccggcctccagtagtattcggcgaagcttgtctaagaactttaaataatttctactgttgtagat
-
SpeciesOther
- Promoter Hsp60
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer unknown
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that several differences were identified in the plasmid backbone compared to the depositor's sequence. These differences do not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCR-Hyg was a gift from Yi-Cheng Sun (Addgene plasmid # 158708 ; http://n2t.net/addgene:158708 ; RRID:Addgene_158708) -
For your References section:
CRISPR-Cas12a-Assisted Recombineering in Bacteria. Yan MY, Yan HQ, Ren GX, Zhao JP, Guo XP, Sun YC. Appl Environ Microbiol. 2017 Aug 17;83(17). pii: AEM.00947-17. doi: 10.1128/AEM.00947-17. Print 2017 Sep 1. 10.1128/AEM.00947-17 PubMed 28646112