TagBFP_A1aY1
(Plasmid
#158752)
-
PurposeLentiviral vector for expression of TagBFP_A1aY1 in mammalian cells for detection of tyrosinated microtubules.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158752 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRIP-CAG vector
-
Backbone manufacturerOriginal pTRIP vector from Nicolas Manel
- Backbone size w/o insert (bp) 11595
- Total vector size (bp) 11787
-
Modifications to backbonepTRIP-CAG vector cloned with TagBFP_A1aY1 in between NheI and BamHI restriction sites.
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTagBFP-T_A1aY1
-
Alt nameBlue tyrosination sensor
-
Alt nameBlue A1aY1 sensor
-
Insert Size (bp)192
- Promoter CAG (CMV enhancer and chicken beta actin promoter)
-
Tag
/ Fusion Protein
- TagBFP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGCCTCTGCTAACCATGTTC
- 3′ sequencing primer CACAATCAGCATTGGTAGCTGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byObtained the pTRIP-CAG plasmid from Dr Carsten Janke's lab with permission obtained from Dr Nicolas Manel at Institut Curie, Paris Cedex, France.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TagBFP_A1aY1 was a gift from Minhajuddin Sirajuddin (Addgene plasmid # 158752 ; http://n2t.net/addgene:158752 ; RRID:Addgene_158752) -
For your References section:
Genetically encoded live-cell sensor for tyrosinated microtubules. Kesarwani S, Lama P, Chandra A, Reddy PP, Jijumon AS, Bodakuntla S, Rao BM, Janke C, Das R, Sirajuddin M. J Cell Biol. 2020 Oct 5;219(10). pii: 152071. doi: 10.1083/jcb.201912107. 10.1083/jcb.201912107 PubMed 32886100