Skip to main content
Addgene

6xHis-TagRFP-T_A1aY1
(Plasmid #158754)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158754 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pIRESneo2
  • Backbone manufacturer
    Addgene plasmid # 12298 cloned with 6x-His-TagRFP-T_A1aY1 gene (Rusan et al Mol Biol Cell. 2001 Apr . 12(4):971-80. )
  • Backbone size w/o insert (bp) 6074
  • Total vector size (bp) 6263
  • Modifications to backbone
    Received Addgene plasmid # 12298 and cloned with 6x-His-TagRFP-T_A1aY1 gene in between NheI and BamHI site.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    6xHistidine_TagRFP-T_A1aY1
  • Alt name
    6x His-Red tyrosination sensor
  • Alt name
    6x His-A1aY1 sensor
  • Insert Size (bp)
    189
  • Promoter CMV Promoter
  • Tags / Fusion Proteins
    • 6x-Histidine tag (N terminal on insert)
    • TagRFP-T (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV_Forward Primer
  • 3′ sequencing primer GAGAGGGAGTACTCACCCCAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Obtained Addgene plasmid # 12298 and cloned with 6x-His-TagRFP-T_A1aY1 gene in between NheI and BamHI restriction sites.
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    6xHis-TagRFP-T_A1aY1 was a gift from Minhajuddin Sirajuddin (Addgene plasmid # 158754 ; http://n2t.net/addgene:158754 ; RRID:Addgene_158754)
  • For your References section:

    Genetically encoded live-cell sensor for tyrosinated microtubules. Kesarwani S, Lama P, Chandra A, Reddy PP, Jijumon AS, Bodakuntla S, Rao BM, Janke C, Das R, Sirajuddin M. J Cell Biol. 2020 Oct 5;219(10). pii: 152071. doi: 10.1083/jcb.201912107. 10.1083/jcb.201912107 PubMed 32886100