6xHis-TagRFP-T_A1aY1
(Plasmid
#158754)
-
PurposeExpression of 6x His tagged TagRFP-T_A1aY1 in mammalian cells for detection of tyrosinated microtubules.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158754 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIRESneo2
-
Backbone manufacturerAddgene plasmid # 12298 cloned with 6x-His-TagRFP-T_A1aY1 gene (Rusan et al Mol Biol Cell. 2001 Apr . 12(4):971-80. )
- Backbone size w/o insert (bp) 6074
- Total vector size (bp) 6263
-
Modifications to backboneReceived Addgene plasmid # 12298 and cloned with 6x-His-TagRFP-T_A1aY1 gene in between NheI and BamHI site.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name6xHistidine_TagRFP-T_A1aY1
-
Alt name6x His-Red tyrosination sensor
-
Alt name6x His-A1aY1 sensor
-
Insert Size (bp)189
- Promoter CMV Promoter
-
Tags
/ Fusion Proteins
- 6x-Histidine tag (N terminal on insert)
- TagRFP-T (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV_Forward Primer
- 3′ sequencing primer GAGAGGGAGTACTCACCCCAAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byObtained Addgene plasmid # 12298 and cloned with 6x-His-TagRFP-T_A1aY1 gene in between NheI and BamHI restriction sites.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
6xHis-TagRFP-T_A1aY1 was a gift from Minhajuddin Sirajuddin (Addgene plasmid # 158754 ; http://n2t.net/addgene:158754 ; RRID:Addgene_158754) -
For your References section:
Genetically encoded live-cell sensor for tyrosinated microtubules. Kesarwani S, Lama P, Chandra A, Reddy PP, Jijumon AS, Bodakuntla S, Rao BM, Janke C, Das R, Sirajuddin M. J Cell Biol. 2020 Oct 5;219(10). pii: 152071. doi: 10.1083/jcb.201912107. 10.1083/jcb.201912107 PubMed 32886100