Skip to main content

pKL09-GCaMP6f-mScarlet bb118
(Plasmid #158979)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158979 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    bb118
  • Backbone size w/o insert (bp) 2300
  • Total vector size (bp) 4440
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6f-mScarlet fusion
  • Species
    Synthetic
  • Insert Size (bp)
    2061
  • Mutation
    codon optimized for e. coli from Addgene#100833
  • Promoter Bba_J23118 (sigma 70)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer gctcactcaaaggcggtaat
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    https://www.nature.com/articles/nature12354
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

GCaMP6f was engineered in the paper above, then codon optimized for E. coli on a G-block and cloned into our bb100 backbone to facilitate constitutive expression . Please visit https://doi.org/10.1101/2020.04.23.058362 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKL09-GCaMP6f-mScarlet bb118 was a gift from Joel Kralj (Addgene plasmid # 158979 ; http://n2t.net/addgene:158979 ; RRID:Addgene_158979)
  • For your References section:

    Membrane voltage dysregulation driven by metabolic dysfunction underlies bactericidal activity of aminoglycosides. Bruni GN, Kralj JM. eLife. 2020 Aug 4;9. pii: 58706. doi: 10.7554/eLife.58706. 10.7554/eLife.58706 PubMed 32748785