lenti U6-sgRNA-acRNA SYN-dCas9-P2A-EGFP
(Plasmid
#159086)
-
PurposeExpresses dCas9-P2A-EGFP driven by human SYN promoter and empty CRISPR Display sgRNA/accessory RNA from U6 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159086 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang Addgene plasmid #52961
- Backbone size w/o insert (bp) 6789
- Total vector size (bp) 13374
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameempty crRNA-acRNA backbone, dCas9-P2A-EGFP
-
SpeciesSynthetic
-
Insert Size (bp)6585
- Promoter hSYN, U6
-
Tags
/ Fusion Proteins
- FLAG (C terminal on insert)
- EGFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTATTACAGGGACAGCAGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CRISPR crRNA and acRNA are empty - use BbsI to insert desired crRNA and Esp3I to insert desired acRNA. bioRxiv: https://www.biorxiv.org/content/10.1101/270967v3
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti U6-sgRNA-acRNA SYN-dCas9-P2A-EGFP was a gift from Jeremy Day (Addgene plasmid # 159086 ; http://n2t.net/addgene:159086 ; RRID:Addgene_159086) -
For your References section:
Enhancer RNAs predict enhancer-gene regulatory links and are critical for enhancer function in neuronal systems. Carullo NVN, Phillips Iii RA, Simon RC, Soto SAR, Hinds JE, Salisbury AJ, Revanna JS, Bunner KD, Ianov L, Sultan FA, Savell KE, Gersbach CA, Day JJ. Nucleic Acids Res. 2020 Aug 18. pii: 5893972. doi: 10.1093/nar/gkaa671. 10.1093/nar/gkaa671 PubMed 32810208