Skip to main content
Addgene
Open Menu

pDest-1.7kbfabp6-eGFP-pA-CrymCherry
(Plasmid #159088)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159088 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 159088-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 159088-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pDESTtol2pACrymCherry
  • Backbone manufacturer
    Berger et. al.
  • Vector type
    fluorescent reporter

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    1.7kb fabp6 promoter
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1700
  • Entrez Gene
    fabp6 (a.k.a. zgc:92421)
  • Promoter 1.7kb fabp6

Cloning Information for Gene/Insert 1

  • Cloning method TOPO Cloning
  • 5′ sequencing primer ttaaggccggccGATGATCCCAACCCTGTAATGAGTTCCTGG
  • 3′ sequencing primer aattggcgcgccTTGAGAGCTGAGGTACTGATGGGTGAAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    eGFP
  • Alt name
    tol2kit #383 pME-EGFP

Cloning Information for Gene/Insert 2

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    polyA
  • Alt name
    tol2kit #302 p3E-polyA

Cloning Information for Gene/Insert 3

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDest-1.7kbfabp6-eGFP-pA-CrymCherry was a gift from John Rawls (Addgene plasmid # 159088 ; http://n2t.net/addgene:159088 ; RRID:Addgene_159088)

  • For your References section:

    Fxr signaling and microbial metabolism of bile salts in the zebrafish intestine. Wen J, Mercado GP, Volland A, Doden HL, Lickwar CR, Crooks T, Kakiyama G, Kelly C, Cocchiaro JL, Ridlon JM, Rawls JF. Sci Adv. 2021 Jul 23;7(30). pii: 7/30/eabg1371. doi: 10.1126/sciadv.abg1371. Print 2021 Jul. 10.1126/sciadv.abg1371 PubMed 34301599
Related items:
Commonly requested with: