pDest-1.7kbfabp6-eGFP-pA-CrymCherry
(Plasmid
#159088)
-
PurposeLR construct using backbone with Cry:mCherry insert to identify fish with transgene, and with p5E-1.7kbfabp6, pME-eGFP, and p3E-pA inserts
-
Depositing Lab
-
Depositing OrganizationDuke University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159088 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 159088-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 159088-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepDESTtol2pACrymCherry
-
Backbone manufacturerBerger et. al.
-
Vector typefluorescent reporter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert name1.7kb fabp6 promoter
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1700
-
Entrez Genefabp6 (a.k.a. zgc:92421)
- Promoter 1.7kb fabp6
Cloning Information for Gene/Insert 1
- Cloning method TOPO Cloning
- 5′ sequencing primer ttaaggccggccGATGATCCCAACCCTGTAATGAGTTCCTGG
- 3′ sequencing primer aattggcgcgccTTGAGAGCTGAGGTACTGATGGGTGAAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameeGFP
-
Alt nametol2kit #383 pME-EGFP
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namepolyA
-
Alt nametol2kit #302 p3E-polyA
Cloning Information for Gene/Insert 3
- Cloning method Gateway Cloning
- 5′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 159088-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 159088-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDest-1.7kbfabp6-eGFP-pA-CrymCherry was a gift from John Rawls (Addgene plasmid # 159088 ; http://n2t.net/addgene:159088 ; RRID:Addgene_159088) -
For your References section:
Fxr signaling and microbial metabolism of bile salts in the zebrafish intestine. Wen J, Mercado GP, Volland A, Doden HL, Lickwar CR, Crooks T, Kakiyama G, Kelly C, Cocchiaro JL, Ridlon JM, Rawls JF. Sci Adv. 2021 Jul 23;7(30). pii: 7/30/eabg1371. doi: 10.1126/sciadv.abg1371. Print 2021 Jul. 10.1126/sciadv.abg1371 PubMed 34301599