pDest-1.7kbfabp6-eGFP-pA-CrymCherry
(Plasmid #159088)

• Purpose: LR construct using backbone with Cry:mCherry insert to identify fish with transgene, and with p5E-1.7kbfabp6, pME-eGFP, and p3E-pA inserts
• Depositing Lab: John Rawls
• Publication: Wen et al Sci Adv. 2021 Jul 23;7(30). pii: 7/30/eabg1371. doi: 10.1126/sciadv.abg1371. Print 2021 Jul.

Backbone

• Vector backbone: pDESTtol2pACrymCherry
• Backbone manufacturer: Berger et. al.
• Vector type: fluorescent reporter

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: 1.7kb fabp6 promoter
• Species: D. rerio (zebrafish)
• Insert Size (bp): 1700
• Entrez Gene: fabp6 (a.k.a. zgc:92421)
• Promoter: 1.7kb fabp6

Cloning Information for Gene/Insert 1

• Cloning method: TOPO Cloning
• 5′ sequencing primer: ttaaggccggccGATGATCCCAACCCTGTAATGAGTTCCTGG
• 3′ sequencing primer: aattggcgcgccTTGAGAGCTGAGGTACTGATGGGTGAAG

Gene/Insert 2

• Gene/Insert name: eGFP
• Alt name: tol2kit #383 pME-EGFP

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG

Gene/Insert 3

• Gene/Insert name: polyA
• Alt name: tol2kit #302 p3E-polyA

Cloning Information for Gene/Insert 3

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry