CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector
(Plasmid
#159281)
-
PurposeA multicistronic vector with both CAGGS promoter-driven AsCpf1 and U6 promoter-driven single guide RNA (sgRNA)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159281 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCDNA3.1
-
Vector typeMammalian Expression ; Multicistronic vector with both CAGGS promoter-driven AsCpf1 and U6 promoter-driven single guide RNA (sgRNA)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAsCpf1-HA-2A-GFP
-
Insert Size (bp)4881
- Promoter U6
-
Tag
/ Fusion Protein
- 3X HA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
- 3′ cloning site BbsI (unknown if destroyed)
- 5′ sequencing primer gagggcctatttcccatgattcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector was a gift from Rudolf Jaenisch (Addgene plasmid # 159281 ; http://n2t.net/addgene:159281 ; RRID:Addgene_159281) -
For your References section:
Human T Cells Expressing a CD19 CAR-T Receptor Provide Insights into Mechanisms of Human CD19-Positive beta Cell Destruction. Ma H, Jeppesen JF, Jaenisch R. Cell Rep Med. 2020 Sep 22;1(6):100097. doi: 10.1016/j.xcrm.2020.100097. eCollection 2020 Sep 22. 10.1016/j.xcrm.2020.100097 PubMed 33205073