AAVS1-pur-CAG-Bi-DREADD
(Plasmid
#159457)
-
PurposeAAVS1 targeting donor plasmid with Bi-DREADD expression cassette (hM3Dq-mCherry-P2A-HA-KORD) and puromycin selection gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAVS1-CAG
- Backbone size w/o insert (bp) 10200
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBi-DREADD
-
Alt namehM3Dq-mCherry-P2A-HA-KORD
-
SpeciesSynthetic
-
Insert Size (bp)3741
-
Mutationfusion protein of hM3Dq-mCherry and HA-KORD seperated by P2A sequence
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer ggcttctggcgtgtgaccggc
- 3′ sequencing primer catagcgtaaaaggagcaaca
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-pur-CAG-Bi-DREADD was a gift from Yuejun Chen (Addgene plasmid # 159457 ; http://n2t.net/addgene:159457 ; RRID:Addgene_159457) -
For your References section:
Human Stem Cell-Derived Neurons Repair Circuits and Restore Neural Function. Xiong M, Tao Y, Gao Q, Feng B, Yan W, Zhou Y, Kotsonis TA, Yuan T, You Z, Wu Z, Xi J, Haberman A, Graham J, Block J, Zhou W, Chen Y, Zhang SC. Cell Stem Cell. 2020 Sep 16. pii: S1934-5909(20)30410-0. doi: 10.1016/j.stem.2020.08.014. 10.1016/j.stem.2020.08.014 PubMed 32966778