pscALPSpuro-RsACE2
(Plasmid
#159665)
-
PurposeExpresses Rhinolophus sinicus ACE2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159665 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepscALPS puro
- Total vector size (bp) 10143
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerhinolophus sinicus ACE2
-
Speciesrhinolophus sinicus
-
Insert Size (bp)2477
-
Entrez GeneACE2
- Promoter SFFV
-
Tag
/ Fusion Protein
- Myc tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGCTTCTGTTCGCGCGCTTC
- 3′ sequencing primer GCGAACGCAGGCCTCAAGGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pscALPSpuro-RsACE2 was a gift from Jeremy Luban (Addgene plasmid # 159665 ; http://n2t.net/addgene:159665 ; RRID:Addgene_159665) -
For your References section:
Structural and Functional Analysis of the D614G SARS-CoV-2 Spike Protein Variant. Yurkovetskiy L, Wang X, Pascal KE, Tomkins-Tinch C, Nyalile TP, Wang Y, Baum A, Diehl WE, Dauphin A, Carbone C, Veinotte K, Egri SB, Schaffner SF, Lemieux JE, Munro JB, Rafique A, Barve A, Sabeti PC, Kyratsous CA, Dudkina NV, Shen K, Luban J. Cell. 2020 Sep 15. pii: S0092-8674(20)31229-0. doi: 10.1016/j.cell.2020.09.032. 10.1016/j.cell.2020.09.032 PubMed 32991842