Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pscALPSpuro-RsACE2
(Plasmid #159665)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 159665 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pscALPS puro
  • Total vector size (bp) 10143
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rhinolophus sinicus ACE2
  • Species
    rhinolophus sinicus
  • Insert Size (bp)
    2477
  • Entrez Gene
    ACE2
  • Promoter SFFV
  • Tag / Fusion Protein
    • Myc tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGCTTCTGTTCGCGCGCTTC
  • 3′ sequencing primer GCGAACGCAGGCCTCAAGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pscALPSpuro-RsACE2 was a gift from Jeremy Luban (Addgene plasmid # 159665 ; http://n2t.net/addgene:159665 ; RRID:Addgene_159665)
  • For your References section:

    Structural and Functional Analysis of the D614G SARS-CoV-2 Spike Protein Variant. Yurkovetskiy L, Wang X, Pascal KE, Tomkins-Tinch C, Nyalile TP, Wang Y, Baum A, Diehl WE, Dauphin A, Carbone C, Veinotte K, Egri SB, Schaffner SF, Lemieux JE, Munro JB, Rafique A, Barve A, Sabeti PC, Kyratsous CA, Dudkina NV, Shen K, Luban J. Cell. 2020 Sep 15. pii: S0092-8674(20)31229-0. doi: 10.1016/j.cell.2020.09.032. 10.1016/j.cell.2020.09.032 PubMed 32991842