Intron-Tagging-pX330-Cas9-Blast
(Plasmid
#159741)
-
PurposeExpresses Cas9-2A-Blast and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159741 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepU6-(BbsI)_CBh-Cas9-T2A-mCherry (Plasmid #64324)
-
Backbone manufacturerRalf Kuehn lab
-
Modifications to backbonemCherry was replaced with a Blasticidin resistance (BSD) using Gibson Assembly.
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedonor plasmid targeting sgRNA
-
gRNA/shRNA sequencegagatcgagtgccgcatcac
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Intron-Tagging-pX330-Cas9-Blast was a gift from Stefan Kubicek (Addgene plasmid # 159741 ; http://n2t.net/addgene:159741 ; RRID:Addgene_159741) -
For your References section:
Pooled protein tagging, cellular imaging, and in situ sequencing for monitoring drug action in real time. Reicher A, Koren A, Kubicek S. Genome Res. 2020 Dec;30(12):1846-1855. doi: 10.1101/gr.261503.120. Epub 2020 Nov 17. 10.1101/gr.261503.120 PubMed 33203764