-
PurposeUpdated light-inducible Cre recombinase split with Vivid photodimers for bacterial expression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160400 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBbS5a
- Backbone size w/o insert (bp) 5118
- Total vector size (bp) 7126
-
Vector typeBacterial Expression, Cre/Lox, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsWhen transformed with Cre reporter, store in the dark.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameOpto-Cre-Vvd-2
-
Alt namenCre-Vvd/Vvd-cCre
-
SpeciesSynthetic
-
Insert Size (bp)2008
- Promoter lacUV5
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggaattgtgagcggataacaatttc
- 3′ sequencing primer cgttttatttgatgcctggagatcc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbS5a-Opto-Cre-Vvd-2 was a gift from Mary Dunlop (Addgene plasmid # 160400 ; http://n2t.net/addgene:160400 ; RRID:Addgene_160400) -
For your References section:
Light-Inducible Recombinases for Bacterial Optogenetics. Sheets MB, Wong WW, Dunlop MJ. ACS Synth Biol. 2020 Feb 21;9(2):227-235. doi: 10.1021/acssynbio.9b00395. Epub 2020 Jan 21. 10.1021/acssynbio.9b00395 PubMed 31961670