pDEST-Tol2-PA2-CMV-AB-mCh
(Plasmid
#160435)
-
PurposeExpresses human Amyloid Beta-mCherry in Zebrafish
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160435 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDEST-Tol2-PA2
- Total vector size (bp) 5148
-
Vector typeZebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman Amyloid Beta peptide (1-42)
-
Alt nameHomo sapiens amyloid beta precursor protein
-
SpeciesH. sapiens (human), D. rerio (zebrafish)
-
Entrez GeneAPP (a.k.a. AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2, alpha-sAPP, preA4)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer hAmyloid Beta_fwd: ataagcagagctatggatgcagaattccgacatgactcag
- 3′ sequencing primer mCherry_rev: tatcttatcatgtctggatcatcatgtacagctcgtccatgccgccggtg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST-Tol2-PA2-CMV-AB-mCh was a gift from Nicholas Tolwinski (Addgene plasmid # 160435 ; http://n2t.net/addgene:160435 ; RRID:Addgene_160435) -
For your References section:
Use of Optogenetic Amyloid-beta to Monitor Protein Aggregation in Drosophila melanogaster, Danio rerio and Caenorhabditis elegans. Kaur P, Kibat C, Teo E, Gruber J, Mathuru A, Tolwinski ANS. Bio Protoc. 2020 Dec 5;10(23):e3856. doi: 10.21769/BioProtoc.3856. eCollection 2020 Dec 5. 10.21769/BioProtoc.3856 PubMed 33659494