Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDEST-Tol2-PA2-CMV-AB-mCh
(Plasmid #160435)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 160435 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDEST-Tol2-PA2
  • Total vector size (bp) 5148
  • Vector type
    Zebrafish expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human Amyloid Beta peptide (1-42)
  • Alt name
    Homo sapiens amyloid beta precursor protein
  • Species
    H. sapiens (human), D. rerio (zebrafish)
  • Entrez Gene
    APP (a.k.a. AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2, alpha-sAPP, preA4)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer hAmyloid Beta_fwd: ataagcagagctatggatgcagaattccgacatgactcag
  • 3′ sequencing primer mCherry_rev: tatcttatcatgtctggatcatcatgtacagctcgtccatgccgccggtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST-Tol2-PA2-CMV-AB-mCh was a gift from Nicholas Tolwinski (Addgene plasmid # 160435 ; http://n2t.net/addgene:160435 ; RRID:Addgene_160435)
  • For your References section:

    Use of Optogenetic Amyloid-beta to Monitor Protein Aggregation in Drosophila melanogaster, Danio rerio and Caenorhabditis elegans. Kaur P, Kibat C, Teo E, Gruber J, Mathuru A, Tolwinski ANS. Bio Protoc. 2020 Dec 5;10(23):e3856. doi: 10.21769/BioProtoc.3856. eCollection 2020 Dec 5. 10.21769/BioProtoc.3856 PubMed 33659494