pDGB3 omega1 P35S:MS2:VPR:Tnos - P35S:dCas9:EDLL:Tnos (GB2085)
(Plasmid
#160645)
-
PurposeModule for the expression of Ms2 protein fused to VPR and dCas9 fused to EDLL
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160645 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDGB3_omega1
-
Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameP35s-Ms2:VPR-Tnos-35s-dCas9:EDLL-Tnos
-
SpeciesSynthetic
-
Insert Size (bp)8972
-
MutationBsmBI sites removed
- Promoter 35S x2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer CTATCCTTCGCAAGACCCTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compatible with GoldenBraid; insert can be released with BsaI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB3 omega1 P35S:MS2:VPR:Tnos - P35S:dCas9:EDLL:Tnos (GB2085) was a gift from Diego Orzaez (Addgene plasmid # 160645 ; http://n2t.net/addgene:160645 ; RRID:Addgene_160645) -
For your References section:
Strong gene activation in plants with genome-wide specificity using a new orthogonal CRISPR/Cas9-based programmable transcriptional activator. Selma S, Bernabe-Orts JM, Vazquez-Vilar M, Diego-Martin B, Ajenjo M, Garcia-Carpintero V, Granell A, Orzaez D. Plant Biotechnol J. 2019 Sep;17(9):1703-1705. doi: 10.1111/pbi.13138. Epub 2019 May 23. 10.1111/pbi.13138 PubMed 31034138